The program gruppi takes the following arguments:

1) The file name containing the list of matrices describing the binding sites.
2) The file name containing the sequence(s) in "pir" format

The program gives the list of clusters of binding sites (at least 2 sites in max 300 bp) whose score is above the threshold specified in the matrix file. 
  

example the command:

./binary/gruppi matrix.list sequences/mouse_pir.pir

gives the following output :

Looking for binding sites clustered in MIN_LENGTH bp
 Matrices are OK .....now reading sequences/mouse_pir.pir file
 11310 nt.  score: 300   CACAGGGGCAAAGCTGAAAA+            hnf4_01 M00134
 11458 nt.  score: 162   AAACAAACAAACAACCTTGA-            hnf3b_01 M00131
+-+-+-+-+-+-+-+-+--+-+-+
 11798 nt.  score: 163   ATTTATTTATTTATTTTCTA+            hnf3b_01 M00131
 12054 nt.  score: 194   GCTGTTAATCATTTCACAAA+            HNF1
+-+-+-+-+-+-+-+-+--+-+-+
 16998 nt.  score: 178   AGAGACTTGTTTGCTTCCCA+            hnf3b_01 M00131
 17174 nt.  score: 164   AACAAAACAAACATAAAATA-            hnf3b_01 M00131
 17431 nt.  score: 163   TCAGAGCTGTTTGCTCCTGG+            hnf3b_01 M00131
+-+-+-+-+-+-+-+-+--+-+-+
 17820 nt.  score: 283   AAGTGGCCTTTTCTCCTGCC-            hnf4_01 M00134
 17875 nt.  score: 189   ACTGTTAATCATTTCAGAAC+            HNF1
 17981 nt.  score: 169   TGGAATTTATTTACTTACCA+            hnf3b_01 M00131
+-+-+-+-+-+-+-+-+--+-+-+
 19674 nt.  score: 163   AGGAGAGTAAATATGCAGGG-            hnf3b_01 M00131
 19952 nt.  score: 168   TCAATTCTGTTTGCTTCTAC+            hnf3b_01 M00131
+-+-+-+-+-+-+-+-+--+-+-+
 22258 nt.  score: 192   AGGGTTATTTGTTACACAGC+            HNF1
 22400 nt.  score: 286   TTGAAGTTCAAAGTACCTGT+            hnf4_01 M00134
+-+-+-+-+-+-+-+-+--+-+-+
14+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+
C;LOCUS       AB001489    29392 bp    DNA             ROD       21-JAN-1998
C;DEFINITION  Mus musculus DNA for polyimmunoglobulin receptor, complete cds.
C;ACCESSION   AB001489
C;NID         g2804245
C;KEYWORDS    polyimmunoglobulin receptor.
C;SOURCE      Mus musculus (strain:129SVJ) female liver DNA. . . .

